The echinoderm and flatworm mitochondrial code (translation table 9) is a genetic code used by the mitochondria of certain echinoderm and flatworm species.[1]
YouTube Encyclopedic
-
1/3Views:16 6846131 884
-
Bioinformatics Tutorials (Lesson 6):Using ORF Finder program to locate Open Reading Frames
-
B.P. Koirala Institute of Health Sciences 2007 Biology MCQs
-
L15: Aerobic and Anaerobic Respiration | Science and Technology | Crash Course Prelims 2020
Transcription
The code
AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNNKSSSSVVVVAAAADDEEGGGGStarts = -----------------------------------M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (9) | Standard code (1) | |
|---|---|---|---|---|
| AAA | AAA | Asn (N) | Lys (K) | |
| AGA | AGA | Ser (S) | Arg (R) | |
| AGG | AGG | Ser (S) | Arg (R) | |
| TGA | UGA | Trp (W) | STOP = Ter (*) |
Systematic range
- Asterozoa (starfishes) [2]
- Echinozoa (sea urchins) [3][4]
- Rhabditophora among the Platyhelminthes[5]
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [1]
- ^ a b Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 18 March 2016.
- ^ H. Himeno; H. Masaki; T. Kawai; T. Ohta; I. Kumagai; K. Miura; K. Watanabe (1987). "Unusual genetic codes and a novel gene structure for tRNA(AGYSer) in starfish mitochondrial DNA". Gene. 56 (2–3): 219–30. doi:10.1016/0378-1119(87)90139-9. PMID 3678836.
- ^ H. T. Jacobs; D. J. Elliott; V. B. Math; A. Farquharson (20 July 1988). "Nucleotide sequence and gene organization of sea urchin mitochondrial DNA". J Mol Biol. 202 (2): 185–217. doi:10.1016/0022-2836(88)90452-4. PMID 3172215.
- ^ P. Cantatore; M. Roberti; G. Rainaldi; M. N. Gadaleta; C. Saccone (5 July 1989). "The complete nucleotide sequence, gene organization, and genetic code of the mitochondrial genome of Paracentrotus lividus". J Biol Chem. 264 (19): 10965–75. doi:10.1016/S0021-9258(18)60413-2. PMID 2544576.
- ^ M. J. Telford; E. A. Herniou; R. B. Russell; D. T. Littlewood (10 October 2000). "Changes in mitochondrial genetic codes as phylogenetic characters: two examples from the flatworms". Proc Natl Acad Sci U S A. 97 (21): 11359–64. Bibcode:2000PNAS...9711359T. doi:10.1073/pnas.97.21.11359. PMC 17205. PMID 11027335.
 | This genetics article is a stub. You can help Wikipedia by expanding it. |
This page was last edited on 22 April 2022, at 10:16