The Condylostoma nuclear code (translation table 28) is a genetic code used by the nuclear genome of the heterotrich ciliate Condylostoma magnum.[1][2] This code, along with translation tables 27 and 31, is remarkable in that every one of the 64 possible codons can be a sense codon. Experimental evidence suggests that translation termination relies on context, specifically proximity to the poly(A) tail. Near such a tail, PABP could help terminate the protein by recruiting eRF1 and eRF3 to prevent the cognate tRNA from binding.[3]
YouTube Encyclopedic
-
1/3Views:1 633 76857 1892 045 815
-
For Nearly 20 Years the Nuclear Launch Code at all Minuteman Silos in the United States Was 00000000
-
America's Nuclear Weapon Chain of Command, with Eric Schlosser
-
How to Launch a Nuclear Missile
Transcription
The code (28)
AAs = FFLLSSSSYYQQCCWWLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = ----------**--*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (28) | Standard code (1) | |||
|---|---|---|---|---|---|---|
| TAA | UAA | Ter (*) | or | Gln (Q) | Ter (*) | |
TAG
|
UAG
|
Ter (*)
|
or | Gln (Q)
|
Ter (*)
| |
TGA
|
UGA
|
Ter (*)
|
or | Trp (W)
|
Ter (*)
| |
See also
- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [2]
- ^ Heaphy, Stephen M.; Mariotti, Marco; Gladyshev, Vadim N.; Atkins, John F.; Baranov, Pavel V. (2016-11-01). "Novel Ciliate Genetic Code Variants Including the Reassignment of All Three Stop Codons to Sense Codons in Condylostoma magnum". Molecular Biology and Evolution. 33 (11): 2885–2889. doi:10.1093/molbev/msw166. ISSN 0737-4038. PMC 5062323. PMID 27501944.
- ^ a b Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 18 November 2016.
- ^ Swart, Estienne Carl; Serra, Valentina; Petroni, Giulio; Nowacki, Mariusz (2016). "Genetic Codes with No Dedicated Stop Codon: Context-Dependent Translation Termination". Cell. 166 (3): 691–702. doi:10.1016/j.cell.2016.06.020. PMC 4967479. PMID 27426948.
This page was last edited on 4 May 2024, at 08:41