To install click the Add extension button. That's it.

The source code for the WIKI 2 extension is being checked by specialists of the Mozilla Foundation, Google, and Apple. You could also do it yourself at any point in time.

4,5
Kelly Slayton
Congratulations on this excellent venture… what a great idea!
Alexander Grigorievskiy
I use WIKI 2 every day and almost forgot how the original Wikipedia looks like.
What we do. Every page goes through several hundred of perfecting techniques; in live mode. Quite the same Wikipedia. Just better.
.
Leo
Newton
Brights
Milds

From Wikipedia, the free encyclopedia

In mathematics, a subsequence is a sequence that can be derived from another sequence by deleting some or no elements without changing the order of the remaining elements. For example, the sequence is a subsequence of obtained after removal of elements , , and . The relation of one sequence being the subsequence of another is a preorder.

Subsequences can contain consecutive elements which were not consecutive in the original sequence. A subsequence which consists of a consecutive run of elements from the original sequence, such as from , is a substring. The substring is a refinement of the subsequence.

The list of all subsequences for the word "apple" would be "a", "ap", "al", "ae", "app", "apl", "ape", "ale", "appl", "appe", "aple", "apple", "p", "pp", "pl", "pe", "ppl", "ppe", "ple", "pple", "l", "le", "e", "" (empty string).

Common subsequence

Given two sequences X and Y, a sequence Z is said to be a common subsequence of X and Y, if Z is a subsequence of both X and Y. For example, if

and
and

then is said to be a common subsequence of X and Y.

This would not be the longest common subsequence, since Z only has length 3, and the common subsequence has length 4. The longest common subsequence of X and Y is .

Applications

Subsequences have applications to computer science,[1] especially in the discipline of bioinformatics, where computers are used to compare, analyze, and store DNA, RNA, and protein sequences.

Take two sequences of DNA containing 37 elements, say:

SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA

The longest common subsequence of sequences 1 and 2 is:

LCS(SEQ1,SEQ2) = CGTTCGGCTATGCTTCTACTTATTCTA

This can be illustrated by highlighting the 27 elements of the longest common subsequence into the initial sequences:

SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA

Another way to show this is to align the two sequences, i.e., to position elements of the longest common subsequence in a same column (indicated by the vertical bar) and to introduce a special character (here, a dash) for padding of arisen empty subsequences:

SEQ1 = ACGGTGTCGTGCTAT-G--C-TGATGCTGA--CT-T-ATATG-CTA-
        | || ||| ||||| |  | |  | || |  || | || |  |||
SEQ2 = -C-GT-TCG-GCTATCGTACGT--T-CT-ATTCTATGAT-T-TCTAA

Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.

Theorems

See also

Notes

  1. ^ In computer science, string is often used as a synonym for sequence, but it is important to note that substring and subsequence are not synonyms. Substrings are consecutive parts of a string, while subsequences need not be. This means that a substring of a string is always a subsequence of the string, but a subsequence of a string is not always a substring of the string, see: Gusfield, Dan (1999) [1997]. Algorithms on Strings, Trees and Sequences: Computer Science and Computational Biology. USA: Cambridge University Press. p. 4. ISBN 0-521-58519-8.

This article incorporates material from subsequence on PlanetMath, which is licensed under the Creative Commons Attribution/Share-Alike License.

This page was last edited on 7 May 2021, at 13:44
Basis of this page is in Wikipedia. Text is available under the CC BY-SA 3.0 Unported License. Non-text media are available under their specified licenses. Wikipedia® is a registered trademark of the Wikimedia Foundation, Inc. WIKI 2 is an independent company and has no affiliation with Wikimedia Foundation.