| Haplogroup R2 | |
|---|---|
| Possible time of origin | 27,000 BP[1] |
| Possible place of origin | South Asia or Central Asia[1] |
| Ancestor | Haplogroup R |
| Descendants | R2a (M124); R2b (FGC21706) |
| Defining mutations | M479 |
Haplogroup R2, or R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It is one of two primary descendants of Haplogroup R (R-M207), the other being R1 (R-M173).
R-M479 has been concentrated geographically in South Asia and Central Asia since prehistory. It appears to reach its highest levels among the Burusho people in North Pakistan.[2] However, it also appears to be present at low levels in the Caucasus, Iran, Anatolia and Europe.[citation needed]
It has two primary branches: R2a (M124) and R2b (R-FGC21706)
YouTube Encyclopedic
-
1/3Views:2 541180 290131 951
-
Haplogroup R1
-
Modern South Arabians: A Demographic Anomaly
-
Slava - The True Story of Slavic Glory Documentary (Part 1 - Genetic Origins-Dual upload.)
Transcription
Structure
- R (M207/Page37/UTY2)
Source: ISOGG 2017.[1]
Geographical distribution
Most research has tested only for the presence of R-M479 (R2) and R-M124 (R2a) – or SNPs downstream from M124 like P249, P267, L266, PAGES00004, and L381 SNPs). Because the other primary branch, R2b (R-FGC21706) was discovered later than R2a, it has often not been tested for. Hence most results are best described as R2(xR2a).
In addition, relatively little research has been done within South Asia, which is known to have the greatest concentration of R2. (Hence the figures cited in the table right may not be indicative of true frequencies, i.e. Pakistan is the only South Asian country that has been included.)
In 2013, R2(xR2a) was found in 5 out of 19 males from the Burusho minority of North Pakistan.[2]
R2a (R-M124)
Haplogroup R2a (R-M124) is characterized by SNPs M124, F820/Page4, L381, P249,[1] and is mainly found in South Asia, with lower frequencies in Central Asia and the Caucasus.[citation needed] R-M124 is also found in multiple Jewish populations: Iraqi Jews, Persian Jews, Mountain Jews, and Ashkenazi Jews.[3]
R2b (R-FGC21706)
It is found especially in the Indian subcontinent.[4]
Phylogenetic tree
| M479 |
| |||||||||
Description of the SNP M479
| Common Name Marker | M479 |
|---|---|
| YCC Haplogroup | R-M479 |
| Nucleotide change | C to T |
| Amplicon size (bp) reference sequence | 323 |
| Polymorphism position from 5' end | 107 |
| Restriction enzyme variant | HphI |
| RefSNP ID | - |
| Y-position | 19294055 |
| Primer forward 5'-3' | gatactttatcaggcttacttc |
| Primer reverse 5'-3' | aaccaaatctctcagaatcg |
See also
Y-DNA R-M207 subclades
Y-DNA backbone tree
Notes
- ^ a b c d ISOGG, 2017, Y-DNA Haplogroup R and its Subclades – 2017 (17 June 2017).
- ^ a b Julie Di Cristofaro , Erwan Pennarun , Stéphane Mazières, Natalie M. Myres, Alice A. Lin, Shah Aga Temori, Mait Metspalu, Ene Metspalu, Michael Witzel, Roy J. King, Peter A. Underhill, Richard Villems & Jacques Chiaroni , 2013, “Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge”, ‘’PLoS One’’ (October 18). (17 June 2017.)
- ^ Kevin Alan Brook, The Jews of Khazaria, Third Edition, Rowman & Littlefield, 2018, p. 185.
- ^ "R-FGC50227 YTree". YFull. Retrieved 15 February 2024.
External links
- Digging into Haplogroup R2 (Y-DNA)
- List of R2 frequency (404)
- R2-M124-WTY (Walk Through the Y) Project
- The India Genealogical DNA Project
- R2 Y-Chromosome Haplogroup DNA Project
This page was last edited on 15 February 2024, at 12:35